Review





Similar Products

86
Benchling Inc crispr guide rna design tool
Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide rna design tool/product/Benchling Inc
Average 86 stars, based on 1 article reviews
crispr guide rna design tool - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Synthego Inc synthetic guide rnas grnas
Synthetic Guide Rnas Grnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic guide rnas grnas/product/Synthego Inc
Average 86 stars, based on 1 article reviews
synthetic guide rnas grnas - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Synthego Inc multi guide rna targeting pd l1
Generation <t>of</t> <t>PD-L1</t> CAR-T and validation of PD-L1 expression in target cells (A) Schematic of the second-generation PD-L1 CAR construct containing an anti-PD-L1 scFv, CD4 transmembrane domain, and 4-1BB/CD3ζ signaling domains and tEGFR safety switch. (B) Flow cytometry results of PD-L1 expression in HuCCT1, HuCCT1-PD-L1 KO, and SNU1079 cells. (C) Characterization of non-CAR-T and CAR-T showing 98.8% and 98.6% CD3 expression and 1.03% and 28% EGFR expression, respectively.
Multi Guide Rna Targeting Pd L1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multi guide rna targeting pd l1/product/Synthego Inc
Average 86 stars, based on 1 article reviews
multi guide rna targeting pd l1 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Synthego Inc synthetic single guide rnas sgrnas
Optogenetic manipulation of proximity between repetitive genomic loci. (A) Scheme of OptoLoop consisting of a fusion between dCas9 and the optogenetic protein CRY2. OptoLoop is targeted to specific genomic loci by introducing specific <t>sgRNAs.</t> CRY2–CRY2 interactions activated by blue light bridge targeted loci to form a chromatin loop. (B) Left panel, region of chromosome 19 showing sgIDR3 and sgTCF3 target sites, representative Hi-C contact map (data from ) and BACs used in DNA-FISH to label the IDR3 (magenta) and TCF3 loci (green). Right panel, mCherry channel images of U2OS dCas9–3XmCherry–CRY2 cells transfected with sgIDR3 and sgTCF3, kept in dark or illuminated with blue light for 3 h (1 s pulses every 10 s), and fixed. Scale bars: 5 µm. (C) Left panel, representative image of DNA-FISH for IDR3 and TCF3 with specific BAC FISH probes in U2OS cells. Right panel represents a single cell highlighted in left panel (yellow box); the expansion shows a single allele in this cell. Dashed line denotes the distance between the two FISH signals. Scale bars: 20 µm (left panel), 5 µm (right panel), 1 µm (expansion). (D) IDR3–TCF3 distances, calculated for U2OS dCas9–mCherry–CRY2 polyclonal cells transfected with indicated combinations of sgIDR3 and sgTCF3, kept under dark or illuminated for 3 h (1 s pulses every 10 s). Violin plot corresponds to a representative experiment, with black lines representing median distances. Bar plot represents means of two independent experiments. Each dot represents the median of typically 5000–10,000 alleles analyzed per experiment. (E) Fraction of alleles with IDR3-TCF3 distance <0.27 µm measured from DNA-FISH images for U2OS dCas9–mCherry–CRY2 polyclonal cells and three clones of U2OS dCas9–3XmCherry–CRY2 cells, transfected with indicated combinations of sgIDR3 and sgTCF3, and kept in dark or illuminated for 3 h (1 s pulses every 10 s). Each dot represents the fraction of typically 5000–10,000 alleles analyzed per experiment. Bars represent means of two or three independent experiments. (F) Measurement of cell-to-cell heterogeneity in loop formation. Bars with green shades: observed fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm obtained from a representative experiment shown in E with 2500–5000 cells analyzed per sample. Bars with magenta shades: expected fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm assuming that alleles from a same cell are independent between each other (Eqn 2). * P <0.05; *** P <0.001; ns, not significant [two-way ANOVAs followed by post-hoc Tukey tests (D,E); paired two-tailed t -test (E); chi-squared test (F)].
Synthetic Single Guide Rnas Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/synthetic single guide rnas sgrnas/product/Synthego Inc
Average 86 stars, based on 1 article reviews
synthetic single guide rnas sgrnas - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

95
OriGene guide rna grna sequences
Optogenetic manipulation of proximity between repetitive genomic loci. (A) Scheme of OptoLoop consisting of a fusion between dCas9 and the optogenetic protein CRY2. OptoLoop is targeted to specific genomic loci by introducing specific <t>sgRNAs.</t> CRY2–CRY2 interactions activated by blue light bridge targeted loci to form a chromatin loop. (B) Left panel, region of chromosome 19 showing sgIDR3 and sgTCF3 target sites, representative Hi-C contact map (data from ) and BACs used in DNA-FISH to label the IDR3 (magenta) and TCF3 loci (green). Right panel, mCherry channel images of U2OS dCas9–3XmCherry–CRY2 cells transfected with sgIDR3 and sgTCF3, kept in dark or illuminated with blue light for 3 h (1 s pulses every 10 s), and fixed. Scale bars: 5 µm. (C) Left panel, representative image of DNA-FISH for IDR3 and TCF3 with specific BAC FISH probes in U2OS cells. Right panel represents a single cell highlighted in left panel (yellow box); the expansion shows a single allele in this cell. Dashed line denotes the distance between the two FISH signals. Scale bars: 20 µm (left panel), 5 µm (right panel), 1 µm (expansion). (D) IDR3–TCF3 distances, calculated for U2OS dCas9–mCherry–CRY2 polyclonal cells transfected with indicated combinations of sgIDR3 and sgTCF3, kept under dark or illuminated for 3 h (1 s pulses every 10 s). Violin plot corresponds to a representative experiment, with black lines representing median distances. Bar plot represents means of two independent experiments. Each dot represents the median of typically 5000–10,000 alleles analyzed per experiment. (E) Fraction of alleles with IDR3-TCF3 distance <0.27 µm measured from DNA-FISH images for U2OS dCas9–mCherry–CRY2 polyclonal cells and three clones of U2OS dCas9–3XmCherry–CRY2 cells, transfected with indicated combinations of sgIDR3 and sgTCF3, and kept in dark or illuminated for 3 h (1 s pulses every 10 s). Each dot represents the fraction of typically 5000–10,000 alleles analyzed per experiment. Bars represent means of two or three independent experiments. (F) Measurement of cell-to-cell heterogeneity in loop formation. Bars with green shades: observed fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm obtained from a representative experiment shown in E with 2500–5000 cells analyzed per sample. Bars with magenta shades: expected fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm assuming that alleles from a same cell are independent between each other (Eqn 2). * P <0.05; *** P <0.001; ns, not significant [two-way ANOVAs followed by post-hoc Tukey tests (D,E); paired two-tailed t -test (E); chi-squared test (F)].
Guide Rna Grna Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna grna sequences/product/OriGene
Average 95 stars, based on 1 article reviews
guide rna grna sequences - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

86
Benchling Inc optimal single guide rna sgrna target sequences
Optogenetic manipulation of proximity between repetitive genomic loci. (A) Scheme of OptoLoop consisting of a fusion between dCas9 and the optogenetic protein CRY2. OptoLoop is targeted to specific genomic loci by introducing specific <t>sgRNAs.</t> CRY2–CRY2 interactions activated by blue light bridge targeted loci to form a chromatin loop. (B) Left panel, region of chromosome 19 showing sgIDR3 and sgTCF3 target sites, representative Hi-C contact map (data from ) and BACs used in DNA-FISH to label the IDR3 (magenta) and TCF3 loci (green). Right panel, mCherry channel images of U2OS dCas9–3XmCherry–CRY2 cells transfected with sgIDR3 and sgTCF3, kept in dark or illuminated with blue light for 3 h (1 s pulses every 10 s), and fixed. Scale bars: 5 µm. (C) Left panel, representative image of DNA-FISH for IDR3 and TCF3 with specific BAC FISH probes in U2OS cells. Right panel represents a single cell highlighted in left panel (yellow box); the expansion shows a single allele in this cell. Dashed line denotes the distance between the two FISH signals. Scale bars: 20 µm (left panel), 5 µm (right panel), 1 µm (expansion). (D) IDR3–TCF3 distances, calculated for U2OS dCas9–mCherry–CRY2 polyclonal cells transfected with indicated combinations of sgIDR3 and sgTCF3, kept under dark or illuminated for 3 h (1 s pulses every 10 s). Violin plot corresponds to a representative experiment, with black lines representing median distances. Bar plot represents means of two independent experiments. Each dot represents the median of typically 5000–10,000 alleles analyzed per experiment. (E) Fraction of alleles with IDR3-TCF3 distance <0.27 µm measured from DNA-FISH images for U2OS dCas9–mCherry–CRY2 polyclonal cells and three clones of U2OS dCas9–3XmCherry–CRY2 cells, transfected with indicated combinations of sgIDR3 and sgTCF3, and kept in dark or illuminated for 3 h (1 s pulses every 10 s). Each dot represents the fraction of typically 5000–10,000 alleles analyzed per experiment. Bars represent means of two or three independent experiments. (F) Measurement of cell-to-cell heterogeneity in loop formation. Bars with green shades: observed fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm obtained from a representative experiment shown in E with 2500–5000 cells analyzed per sample. Bars with magenta shades: expected fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm assuming that alleles from a same cell are independent between each other (Eqn 2). * P <0.05; *** P <0.001; ns, not significant [two-way ANOVAs followed by post-hoc Tukey tests (D,E); paired two-tailed t -test (E); chi-squared test (F)].
Optimal Single Guide Rna Sgrna Target Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/optimal single guide rna sgrna target sequences/product/Benchling Inc
Average 86 stars, based on 1 article reviews
optimal single guide rna sgrna target sequences - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Benchling Inc single guide rnas sgrnas
Optogenetic manipulation of proximity between repetitive genomic loci. (A) Scheme of OptoLoop consisting of a fusion between dCas9 and the optogenetic protein CRY2. OptoLoop is targeted to specific genomic loci by introducing specific <t>sgRNAs.</t> CRY2–CRY2 interactions activated by blue light bridge targeted loci to form a chromatin loop. (B) Left panel, region of chromosome 19 showing sgIDR3 and sgTCF3 target sites, representative Hi-C contact map (data from ) and BACs used in DNA-FISH to label the IDR3 (magenta) and TCF3 loci (green). Right panel, mCherry channel images of U2OS dCas9–3XmCherry–CRY2 cells transfected with sgIDR3 and sgTCF3, kept in dark or illuminated with blue light for 3 h (1 s pulses every 10 s), and fixed. Scale bars: 5 µm. (C) Left panel, representative image of DNA-FISH for IDR3 and TCF3 with specific BAC FISH probes in U2OS cells. Right panel represents a single cell highlighted in left panel (yellow box); the expansion shows a single allele in this cell. Dashed line denotes the distance between the two FISH signals. Scale bars: 20 µm (left panel), 5 µm (right panel), 1 µm (expansion). (D) IDR3–TCF3 distances, calculated for U2OS dCas9–mCherry–CRY2 polyclonal cells transfected with indicated combinations of sgIDR3 and sgTCF3, kept under dark or illuminated for 3 h (1 s pulses every 10 s). Violin plot corresponds to a representative experiment, with black lines representing median distances. Bar plot represents means of two independent experiments. Each dot represents the median of typically 5000–10,000 alleles analyzed per experiment. (E) Fraction of alleles with IDR3-TCF3 distance <0.27 µm measured from DNA-FISH images for U2OS dCas9–mCherry–CRY2 polyclonal cells and three clones of U2OS dCas9–3XmCherry–CRY2 cells, transfected with indicated combinations of sgIDR3 and sgTCF3, and kept in dark or illuminated for 3 h (1 s pulses every 10 s). Each dot represents the fraction of typically 5000–10,000 alleles analyzed per experiment. Bars represent means of two or three independent experiments. (F) Measurement of cell-to-cell heterogeneity in loop formation. Bars with green shades: observed fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm obtained from a representative experiment shown in E with 2500–5000 cells analyzed per sample. Bars with magenta shades: expected fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm assuming that alleles from a same cell are independent between each other (Eqn 2). * P <0.05; *** P <0.001; ns, not significant [two-way ANOVAs followed by post-hoc Tukey tests (D,E); paired two-tailed t -test (E); chi-squared test (F)].
Single Guide Rnas Sgrnas, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/single guide rnas sgrnas/product/Benchling Inc
Average 86 stars, based on 1 article reviews
single guide rnas sgrnas - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Synthego Inc single guide rna sgrna
(A) <t>A</t> <t>single-guide</t> <t>RNA</t> <t>(sgRNA)</t> containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego) of exon 7. To introduce the mutant sequence, we designed a single-stranded 199-base oligodeoxynucleotide (SPLIS ssOligo) containing the G-to-A SPLIS mutation and a silent point mutation to create a SphI restriction enzyme site for screening: 5’AGGCTGTACCTCCTGATACCCATCCTTAACTTACTCTGGTTTCTTTTCTTCACATAG GTGACTTCTGGGGGAACGGAAAGCATCCTGATGGCATGCAAAGCTTACCAGGACTT GGCGTTAGAGAAGGGGATCAAAACTCCAGAAATGTATGGATGTGTGTGTTTGTTTCC CTTCTGATATTGTCTATTTGTGGCAGCAC 3’ (Ultramer DNA, IDT). The C57BL/6J strain was used as an embryo donor. Fertilized oocytes were injected with Cas9 protein (TrueCut Cas9 protein V2, Thermofisher), the sgRNA, and the SPLIS ssOligo and transferred to the oviducts of pseudopregnant female mice. (B) Mice were genotyped by PCR. The resulting PCR product (443 bp) was digested with SphI to detect the mutant sequence. After digestion, the WT allele yielded a 443 bp fragment; the SPLIS-modified allele yielded 275 bp and 167 bp bands. We detected 1 founder whose PCR fragment was digested by SphI (out of 99 offspring screened). Sequences of the undigested PCR fragments were determined after TOPO TA cloning (ThermoFisher) by Sanger sequencing. The founder female carried one allele containing R222Q mutation and SphI restriction site and one allele with a 38-bp deletion in exon 7, resulting in a frameshift and premature stop codon (A, B). (C) When mated with a WT male, the founder produced 4 pups, 2 Sgpl1 R222Q/WT and 2 Sgpl1 del/WT, segregating the 2 alleles.
Single Guide Rna Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/single guide rna sgrna/product/Synthego Inc
Average 86 stars, based on 1 article reviews
single guide rna sgrna - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Synthego Inc single guide rnas sgrnas
(A) <t>A</t> <t>single-guide</t> <t>RNA</t> <t>(sgRNA)</t> containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego) of exon 7. To introduce the mutant sequence, we designed a single-stranded 199-base oligodeoxynucleotide (SPLIS ssOligo) containing the G-to-A SPLIS mutation and a silent point mutation to create a SphI restriction enzyme site for screening: 5’AGGCTGTACCTCCTGATACCCATCCTTAACTTACTCTGGTTTCTTTTCTTCACATAG GTGACTTCTGGGGGAACGGAAAGCATCCTGATGGCATGCAAAGCTTACCAGGACTT GGCGTTAGAGAAGGGGATCAAAACTCCAGAAATGTATGGATGTGTGTGTTTGTTTCC CTTCTGATATTGTCTATTTGTGGCAGCAC 3’ (Ultramer DNA, IDT). The C57BL/6J strain was used as an embryo donor. Fertilized oocytes were injected with Cas9 protein (TrueCut Cas9 protein V2, Thermofisher), the sgRNA, and the SPLIS ssOligo and transferred to the oviducts of pseudopregnant female mice. (B) Mice were genotyped by PCR. The resulting PCR product (443 bp) was digested with SphI to detect the mutant sequence. After digestion, the WT allele yielded a 443 bp fragment; the SPLIS-modified allele yielded 275 bp and 167 bp bands. We detected 1 founder whose PCR fragment was digested by SphI (out of 99 offspring screened). Sequences of the undigested PCR fragments were determined after TOPO TA cloning (ThermoFisher) by Sanger sequencing. The founder female carried one allele containing R222Q mutation and SphI restriction site and one allele with a 38-bp deletion in exon 7, resulting in a frameshift and premature stop codon (A, B). (C) When mated with a WT male, the founder produced 4 pups, 2 Sgpl1 R222Q/WT and 2 Sgpl1 del/WT, segregating the 2 alleles.
Single Guide Rnas Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/single guide rnas sgrnas/product/Synthego Inc
Average 86 stars, based on 1 article reviews
single guide rnas sgrnas - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Axolabs Inc nucleotide guide rnas
(A) <t>A</t> <t>single-guide</t> <t>RNA</t> <t>(sgRNA)</t> containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego) of exon 7. To introduce the mutant sequence, we designed a single-stranded 199-base oligodeoxynucleotide (SPLIS ssOligo) containing the G-to-A SPLIS mutation and a silent point mutation to create a SphI restriction enzyme site for screening: 5’AGGCTGTACCTCCTGATACCCATCCTTAACTTACTCTGGTTTCTTTTCTTCACATAG GTGACTTCTGGGGGAACGGAAAGCATCCTGATGGCATGCAAAGCTTACCAGGACTT GGCGTTAGAGAAGGGGATCAAAACTCCAGAAATGTATGGATGTGTGTGTTTGTTTCC CTTCTGATATTGTCTATTTGTGGCAGCAC 3’ (Ultramer DNA, IDT). The C57BL/6J strain was used as an embryo donor. Fertilized oocytes were injected with Cas9 protein (TrueCut Cas9 protein V2, Thermofisher), the sgRNA, and the SPLIS ssOligo and transferred to the oviducts of pseudopregnant female mice. (B) Mice were genotyped by PCR. The resulting PCR product (443 bp) was digested with SphI to detect the mutant sequence. After digestion, the WT allele yielded a 443 bp fragment; the SPLIS-modified allele yielded 275 bp and 167 bp bands. We detected 1 founder whose PCR fragment was digested by SphI (out of 99 offspring screened). Sequences of the undigested PCR fragments were determined after TOPO TA cloning (ThermoFisher) by Sanger sequencing. The founder female carried one allele containing R222Q mutation and SphI restriction site and one allele with a 38-bp deletion in exon 7, resulting in a frameshift and premature stop codon (A, B). (C) When mated with a WT male, the founder produced 4 pups, 2 Sgpl1 R222Q/WT and 2 Sgpl1 del/WT, segregating the 2 alleles.
Nucleotide Guide Rnas, supplied by Axolabs Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nucleotide guide rnas/product/Axolabs Inc
Average 86 stars, based on 1 article reviews
nucleotide guide rnas - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results


Generation of PD-L1 CAR-T and validation of PD-L1 expression in target cells (A) Schematic of the second-generation PD-L1 CAR construct containing an anti-PD-L1 scFv, CD4 transmembrane domain, and 4-1BB/CD3ζ signaling domains and tEGFR safety switch. (B) Flow cytometry results of PD-L1 expression in HuCCT1, HuCCT1-PD-L1 KO, and SNU1079 cells. (C) Characterization of non-CAR-T and CAR-T showing 98.8% and 98.6% CD3 expression and 1.03% and 28% EGFR expression, respectively.

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Generation of PD-L1 CAR-T and validation of PD-L1 expression in target cells (A) Schematic of the second-generation PD-L1 CAR construct containing an anti-PD-L1 scFv, CD4 transmembrane domain, and 4-1BB/CD3ζ signaling domains and tEGFR safety switch. (B) Flow cytometry results of PD-L1 expression in HuCCT1, HuCCT1-PD-L1 KO, and SNU1079 cells. (C) Characterization of non-CAR-T and CAR-T showing 98.8% and 98.6% CD3 expression and 1.03% and 28% EGFR expression, respectively.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Biomarker Discovery, Expressing, Construct, Flow Cytometry

PD-L1 CAR-T delay tumor progression and reduce tumor burden in vivo (A) Longitudinal bioluminescent imaging of mice with orthotopic HuCCT1 tumors treated with PBS as a control, Non-CAR-T, or CAR-T at 7 and 14 days. (B) Quantification of total bioluminescent signal confirming significantly reduced tumor burden in CAR-T treated animals compared with both control groups. Results are reported as mean ± standard deviation (SD). Two-way ANOVA with Tukey’s multiple comparisons between tumor control and CAR-T are represented by ( p values: ∗∗ ≤0.01), and between non-CAR-T and CAR-T by ( p values: # # ≤ 0.01). n = 6 biological replicates at all days and time points with the exception of non-CAR-T week 9, where n = 5 biological replicates.

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: PD-L1 CAR-T delay tumor progression and reduce tumor burden in vivo (A) Longitudinal bioluminescent imaging of mice with orthotopic HuCCT1 tumors treated with PBS as a control, Non-CAR-T, or CAR-T at 7 and 14 days. (B) Quantification of total bioluminescent signal confirming significantly reduced tumor burden in CAR-T treated animals compared with both control groups. Results are reported as mean ± standard deviation (SD). Two-way ANOVA with Tukey’s multiple comparisons between tumor control and CAR-T are represented by ( p values: ∗∗ ≤0.01), and between non-CAR-T and CAR-T by ( p values: # # ≤ 0.01). n = 6 biological replicates at all days and time points with the exception of non-CAR-T week 9, where n = 5 biological replicates.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: In Vivo, Imaging, Control, Standard Deviation

Antigen-specific degranulation and granzyme B released by PD-L1 CAR-T (A) CD8 + T cell degranulation in response to HuCCT1 wild-type (WT) or PD-L1 knockout (KO) cells by flow cytometry after CAR-T co-culture at 6 h. (B) CD4 + T cell degranulation under the same conditions, showing CAR-T-mediated activity against WT but not KO cells. (C) Degranulation of CD8 + and CD4 + T cells in response to SNU1079 cells by flow cytometry after CART co-culture at 6 h compared with non-CAR-T controls. (D) Granzyme B release in HuCCT1 WT and KO cells following co-culture by ELISA after 72 h n = 3 technical replicates. Two-way ANOVA with Tukey’s multiple comparisons test. ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD).

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Antigen-specific degranulation and granzyme B released by PD-L1 CAR-T (A) CD8 + T cell degranulation in response to HuCCT1 wild-type (WT) or PD-L1 knockout (KO) cells by flow cytometry after CAR-T co-culture at 6 h. (B) CD4 + T cell degranulation under the same conditions, showing CAR-T-mediated activity against WT but not KO cells. (C) Degranulation of CD8 + and CD4 + T cells in response to SNU1079 cells by flow cytometry after CART co-culture at 6 h compared with non-CAR-T controls. (D) Granzyme B release in HuCCT1 WT and KO cells following co-culture by ELISA after 72 h n = 3 technical replicates. Two-way ANOVA with Tukey’s multiple comparisons test. ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD).

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Knock-Out, Flow Cytometry, Co-Culture Assay, Activity Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

CAR-T release cytotoxic effector molecules and reduce tumor cell viability in an antigen-dependent manner (A and B) Granzyme B and perforin release from CAR-T and non-transduced T cells co-cultured with HuCCT1 (A) or SNU1079 (B) cells at 1:1 and 2:1 effector-to-target (E:T) ratios. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase viability assay of HuCCT1, PD-L1 knockout HuCCT1, or SNU1079 cells at 1:1 and 2:1 effector-to-target after 24 and 48 h. n = 6 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. ∗ p value ≤ 0.05, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD).

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: CAR-T release cytotoxic effector molecules and reduce tumor cell viability in an antigen-dependent manner (A and B) Granzyme B and perforin release from CAR-T and non-transduced T cells co-cultured with HuCCT1 (A) or SNU1079 (B) cells at 1:1 and 2:1 effector-to-target (E:T) ratios. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase viability assay of HuCCT1, PD-L1 knockout HuCCT1, or SNU1079 cells at 1:1 and 2:1 effector-to-target after 24 and 48 h. n = 6 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. ∗ p value ≤ 0.05, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD).

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Cell Culture, Luciferase, Viability Assay, Knock-Out, Standard Deviation

PD-L1 CAR-T disrupt and kill tumor cells in multicellular CSFE spheroids (A) Brightfield images of HuCCT1 and SNU1079 CSFE spheroids following 24 h co-culture with non-CAR-T or CAR-T at 1:1 or 2:1 effector-to-target (E:T) ratios. Quantification of spheroid area is shown. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. Scale bar is 300 µm (B) Live/dead staining (calcein-AM/propidium iodide) and luciferase viability assays of spheroids under the same conditions. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. ∗ p value ≤ 0.05, ∗∗ p value ≤ 0.01, ∗∗∗ p value ≤ 0.001, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 100 µm.

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: PD-L1 CAR-T disrupt and kill tumor cells in multicellular CSFE spheroids (A) Brightfield images of HuCCT1 and SNU1079 CSFE spheroids following 24 h co-culture with non-CAR-T or CAR-T at 1:1 or 2:1 effector-to-target (E:T) ratios. Quantification of spheroid area is shown. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. Scale bar is 300 µm (B) Live/dead staining (calcein-AM/propidium iodide) and luciferase viability assays of spheroids under the same conditions. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. ∗ p value ≤ 0.05, ∗∗ p value ≤ 0.01, ∗∗∗ p value ≤ 0.001, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 100 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Co-Culture Assay, Staining, Luciferase, Standard Deviation

Gemcitabine upregulates PD-L1 and enhances CAR-T cytotoxicity in HuCCT1 cells (A) Schematic of experimental design for gemcitabine pretreatment. (B) Flow cytometry showing increased PD-L1 surface expression in HuCCT1 cells after Gem treatment, with maximal induction at 0.2 μM for 48 h. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase-based viability assays at both effector-to-target (E:T) ratios and at 24 and 48 h time points. n = 6 technical replicates, two-way ANOVA with Šídák’s multiple comparisons test. (D) Representative live/dead staining of HuCCT1 CSFE spheroids under the same conditions. ∗∗ p value ≤ 0.01, ∗∗∗ p value ≤ 0.001, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 50 µm.

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Gemcitabine upregulates PD-L1 and enhances CAR-T cytotoxicity in HuCCT1 cells (A) Schematic of experimental design for gemcitabine pretreatment. (B) Flow cytometry showing increased PD-L1 surface expression in HuCCT1 cells after Gem treatment, with maximal induction at 0.2 μM for 48 h. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase-based viability assays at both effector-to-target (E:T) ratios and at 24 and 48 h time points. n = 6 technical replicates, two-way ANOVA with Šídák’s multiple comparisons test. (D) Representative live/dead staining of HuCCT1 CSFE spheroids under the same conditions. ∗∗ p value ≤ 0.01, ∗∗∗ p value ≤ 0.001, ∗∗∗∗ p value ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 50 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Flow Cytometry, Expressing, Luciferase, Staining, Standard Deviation

Gemcitabine upregulates PD-L1 and enhances CAR-T cytotoxicity in SNU1079 cells (A) Schematic depicting Gemcitabine pretreatment. (B) Flow cytometry showing Gemcitabine-induced PD-L1 upregulation in SNU1079 cells, with maximal effect at 0.2 μM for 48 h. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase-based viability assays at both effector-to-target (E:T) ratios and at 24 and 48 h time points. n = 6 technical replicates. Two-way ANOVA with Šídák’s multiple comparisons test. (D) Representative live/dead staining of SNU1079 CSFE spheroids under the same conditions. p value∗ ≤ 0.05, p value∗∗ ≤ 0.01, p value∗∗∗∗ ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 50 µm.

Journal: Molecular Therapy Oncology

Article Title: CAR-T cells directed toward PD-L1 demonstrate potent, antigen-specific activity against cholangiocarcinoma: A proof of concept study

doi: 10.1016/j.omton.2026.201209

Figure Lengend Snippet: Gemcitabine upregulates PD-L1 and enhances CAR-T cytotoxicity in SNU1079 cells (A) Schematic depicting Gemcitabine pretreatment. (B) Flow cytometry showing Gemcitabine-induced PD-L1 upregulation in SNU1079 cells, with maximal effect at 0.2 μM for 48 h. n = 3 technical replicates. One-way ANOVA with Tukey’s multiple comparisons test. (C) Luciferase-based viability assays at both effector-to-target (E:T) ratios and at 24 and 48 h time points. n = 6 technical replicates. Two-way ANOVA with Šídák’s multiple comparisons test. (D) Representative live/dead staining of SNU1079 CSFE spheroids under the same conditions. p value∗ ≤ 0.05, p value∗∗ ≤ 0.01, p value∗∗∗∗ ≤ 0.0001. Results are reported as mean ± standard deviation (SD). Scale bar is 50 µm.

Article Snippet: Cas9 was combined with multi-guide RNA targeting PD-L1 (Synthego, Redwood City, CA, USA) in NEB buffer (New England Biolabs) at a 12:1 ratio and incubated to form RNP complexes.

Techniques: Flow Cytometry, Luciferase, Staining, Standard Deviation

Optogenetic manipulation of proximity between repetitive genomic loci. (A) Scheme of OptoLoop consisting of a fusion between dCas9 and the optogenetic protein CRY2. OptoLoop is targeted to specific genomic loci by introducing specific sgRNAs. CRY2–CRY2 interactions activated by blue light bridge targeted loci to form a chromatin loop. (B) Left panel, region of chromosome 19 showing sgIDR3 and sgTCF3 target sites, representative Hi-C contact map (data from ) and BACs used in DNA-FISH to label the IDR3 (magenta) and TCF3 loci (green). Right panel, mCherry channel images of U2OS dCas9–3XmCherry–CRY2 cells transfected with sgIDR3 and sgTCF3, kept in dark or illuminated with blue light for 3 h (1 s pulses every 10 s), and fixed. Scale bars: 5 µm. (C) Left panel, representative image of DNA-FISH for IDR3 and TCF3 with specific BAC FISH probes in U2OS cells. Right panel represents a single cell highlighted in left panel (yellow box); the expansion shows a single allele in this cell. Dashed line denotes the distance between the two FISH signals. Scale bars: 20 µm (left panel), 5 µm (right panel), 1 µm (expansion). (D) IDR3–TCF3 distances, calculated for U2OS dCas9–mCherry–CRY2 polyclonal cells transfected with indicated combinations of sgIDR3 and sgTCF3, kept under dark or illuminated for 3 h (1 s pulses every 10 s). Violin plot corresponds to a representative experiment, with black lines representing median distances. Bar plot represents means of two independent experiments. Each dot represents the median of typically 5000–10,000 alleles analyzed per experiment. (E) Fraction of alleles with IDR3-TCF3 distance <0.27 µm measured from DNA-FISH images for U2OS dCas9–mCherry–CRY2 polyclonal cells and three clones of U2OS dCas9–3XmCherry–CRY2 cells, transfected with indicated combinations of sgIDR3 and sgTCF3, and kept in dark or illuminated for 3 h (1 s pulses every 10 s). Each dot represents the fraction of typically 5000–10,000 alleles analyzed per experiment. Bars represent means of two or three independent experiments. (F) Measurement of cell-to-cell heterogeneity in loop formation. Bars with green shades: observed fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm obtained from a representative experiment shown in E with 2500–5000 cells analyzed per sample. Bars with magenta shades: expected fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm assuming that alleles from a same cell are independent between each other (Eqn 2). * P <0.05; *** P <0.001; ns, not significant [two-way ANOVAs followed by post-hoc Tukey tests (D,E); paired two-tailed t -test (E); chi-squared test (F)].

Journal: Journal of Cell Science

Article Title: OptoLoop – an optogenetic tool to probe the functional role of genome organization

doi: 10.1242/jcs.264574

Figure Lengend Snippet: Optogenetic manipulation of proximity between repetitive genomic loci. (A) Scheme of OptoLoop consisting of a fusion between dCas9 and the optogenetic protein CRY2. OptoLoop is targeted to specific genomic loci by introducing specific sgRNAs. CRY2–CRY2 interactions activated by blue light bridge targeted loci to form a chromatin loop. (B) Left panel, region of chromosome 19 showing sgIDR3 and sgTCF3 target sites, representative Hi-C contact map (data from ) and BACs used in DNA-FISH to label the IDR3 (magenta) and TCF3 loci (green). Right panel, mCherry channel images of U2OS dCas9–3XmCherry–CRY2 cells transfected with sgIDR3 and sgTCF3, kept in dark or illuminated with blue light for 3 h (1 s pulses every 10 s), and fixed. Scale bars: 5 µm. (C) Left panel, representative image of DNA-FISH for IDR3 and TCF3 with specific BAC FISH probes in U2OS cells. Right panel represents a single cell highlighted in left panel (yellow box); the expansion shows a single allele in this cell. Dashed line denotes the distance between the two FISH signals. Scale bars: 20 µm (left panel), 5 µm (right panel), 1 µm (expansion). (D) IDR3–TCF3 distances, calculated for U2OS dCas9–mCherry–CRY2 polyclonal cells transfected with indicated combinations of sgIDR3 and sgTCF3, kept under dark or illuminated for 3 h (1 s pulses every 10 s). Violin plot corresponds to a representative experiment, with black lines representing median distances. Bar plot represents means of two independent experiments. Each dot represents the median of typically 5000–10,000 alleles analyzed per experiment. (E) Fraction of alleles with IDR3-TCF3 distance <0.27 µm measured from DNA-FISH images for U2OS dCas9–mCherry–CRY2 polyclonal cells and three clones of U2OS dCas9–3XmCherry–CRY2 cells, transfected with indicated combinations of sgIDR3 and sgTCF3, and kept in dark or illuminated for 3 h (1 s pulses every 10 s). Each dot represents the fraction of typically 5000–10,000 alleles analyzed per experiment. Bars represent means of two or three independent experiments. (F) Measurement of cell-to-cell heterogeneity in loop formation. Bars with green shades: observed fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm obtained from a representative experiment shown in E with 2500–5000 cells analyzed per sample. Bars with magenta shades: expected fraction of cells with none, one or both alleles with IDR3–TCF3 distance <0.27 µm assuming that alleles from a same cell are independent between each other (Eqn 2). * P <0.05; *** P <0.001; ns, not significant [two-way ANOVAs followed by post-hoc Tukey tests (D,E); paired two-tailed t -test (E); chi-squared test (F)].

Article Snippet: Synthetic single-guide RNAs (sgRNAs) were custom-ordered from Synthego (Reedwood City, CA, USA) and are listed in . sgRNAs were synthesized with a 2′-O-methyl modification at the three first and last bases, and 3′ phosphorothioate bonds between the third- and second-last bases for increased stability.

Techniques: Hi-C, Transfection, Single Cell, Clone Assay, Two Tailed Test

Functional effects of genome organization manipulation on gene regulation. (A) Scheme of ‘telomere position effect over long distances’ model. Gene repression by long-range looping with telomere depends on telomere length. (B) Region of chromosome 5 showing sgSubtel (sgSubtel1+sgSubtel2) and sgTERT (sgTERT1+sgTERT2) target sites, and BACs used in DNA-FISH to label the 5p subtelomeric region (Subtel, green) and the TERT locus (magenta). (C) Left panel, representative image of DNA-FISH with Subtel and TERT BAC probes in HeLa cells. Scale bar: 5 µm. Right panel, fraction of alleles with Subtel- TERT distance <0.27 µm measured from DNA-FISH images of HeLa cells stably expressing dCas9-3XGFP-CRY2, transfected with none or sgSubtel and sgTERT sgRNAs, and kept under dark or illuminated with blue light for 3 h (1 s pulses every 10 s). Each dot represents the fraction of typically 6000–20,000 alleles analyzed per experiment. Bars represent the means of two experiments. Values are represented as relative to control (no sgRNAs, no light). (D) Representative image of RNA/DNA-FISH with RNA probes against TERT pre-mRNA and Subtel and TERT BAC probes in HeLa. Expansion shows a single allele (highlighted with a yellow square). Scale bars: 5 µm (left image), 1 µm (expansion). (E) Number of active TERT transcription sites (TSs) per cell (left panel) and total TERT pre-mRNA intensity (right panel) measured from RNA/DNA-FISH images from HeLa cells stably expressing dCas9–3XGFP–CRY2, transfected with none or sgSubtel and sgTERT sgRNAs, and illuminated with blue light for 4 h (1 s pulses every 10 s). Cells were binned according to their fraction of alleles with Subtel- TERT distance <0.27 µm. Average measurements from the whole population of cells (i.e. not binned) are also shown. Each dot represents the mean of typically 150–1500 cells analyzed per bin, per experiment. Bars represent the means of two experiments. RNA total intensity was normalized to that of control (bin ‘0’, no sgRNAs). (F) Fraction of alleles with Subtel- TERT distance <0.27 µm for alleles classified as active or inactive regarding TERT transcription. Allele transcription status was determined according to the presence or absence of an RNA-FISH signal at a distance <2.5 µm. Data obtained from RNA/DNA-FISH images of HeLa cells stably expressing dCas9–3XGFP–CRY2, transfected with none or sgSubtel and sgTERT sgRNAs, and illuminated with blue light for 4 h (1 s pulses every 10 s). Each dot represents the mean of typically 400–2000 alleles analyzed per condition, per experiment. Bars represent the means of two independent experiments. (G) Fraction of alleles with Subtel– TERT distance <0.27 µm (left panel) and average number of active TERT transcription sites per cell (right panel) measured from a representative RNA/DNA-FISH experiment shown in (E). Cells were binned according to their mean GFP nuclear intensity. Average measurements from whole population of cells (i.e. not binned) are also shown. Each dot represents the fraction of 300–1800 alleles analyzed per bin (left panel) or the mean of 100–600 cells analyzed per bin (right panel). * P <0.05; ** P <0.01; *** P <0.001 [two-way ANOVAs followed by post-hoc Tukey tests (C,E,F and G, right panel); Marascuilo's procedure (G, left panel)].

Journal: Journal of Cell Science

Article Title: OptoLoop – an optogenetic tool to probe the functional role of genome organization

doi: 10.1242/jcs.264574

Figure Lengend Snippet: Functional effects of genome organization manipulation on gene regulation. (A) Scheme of ‘telomere position effect over long distances’ model. Gene repression by long-range looping with telomere depends on telomere length. (B) Region of chromosome 5 showing sgSubtel (sgSubtel1+sgSubtel2) and sgTERT (sgTERT1+sgTERT2) target sites, and BACs used in DNA-FISH to label the 5p subtelomeric region (Subtel, green) and the TERT locus (magenta). (C) Left panel, representative image of DNA-FISH with Subtel and TERT BAC probes in HeLa cells. Scale bar: 5 µm. Right panel, fraction of alleles with Subtel- TERT distance <0.27 µm measured from DNA-FISH images of HeLa cells stably expressing dCas9-3XGFP-CRY2, transfected with none or sgSubtel and sgTERT sgRNAs, and kept under dark or illuminated with blue light for 3 h (1 s pulses every 10 s). Each dot represents the fraction of typically 6000–20,000 alleles analyzed per experiment. Bars represent the means of two experiments. Values are represented as relative to control (no sgRNAs, no light). (D) Representative image of RNA/DNA-FISH with RNA probes against TERT pre-mRNA and Subtel and TERT BAC probes in HeLa. Expansion shows a single allele (highlighted with a yellow square). Scale bars: 5 µm (left image), 1 µm (expansion). (E) Number of active TERT transcription sites (TSs) per cell (left panel) and total TERT pre-mRNA intensity (right panel) measured from RNA/DNA-FISH images from HeLa cells stably expressing dCas9–3XGFP–CRY2, transfected with none or sgSubtel and sgTERT sgRNAs, and illuminated with blue light for 4 h (1 s pulses every 10 s). Cells were binned according to their fraction of alleles with Subtel- TERT distance <0.27 µm. Average measurements from the whole population of cells (i.e. not binned) are also shown. Each dot represents the mean of typically 150–1500 cells analyzed per bin, per experiment. Bars represent the means of two experiments. RNA total intensity was normalized to that of control (bin ‘0’, no sgRNAs). (F) Fraction of alleles with Subtel- TERT distance <0.27 µm for alleles classified as active or inactive regarding TERT transcription. Allele transcription status was determined according to the presence or absence of an RNA-FISH signal at a distance <2.5 µm. Data obtained from RNA/DNA-FISH images of HeLa cells stably expressing dCas9–3XGFP–CRY2, transfected with none or sgSubtel and sgTERT sgRNAs, and illuminated with blue light for 4 h (1 s pulses every 10 s). Each dot represents the mean of typically 400–2000 alleles analyzed per condition, per experiment. Bars represent the means of two independent experiments. (G) Fraction of alleles with Subtel– TERT distance <0.27 µm (left panel) and average number of active TERT transcription sites per cell (right panel) measured from a representative RNA/DNA-FISH experiment shown in (E). Cells were binned according to their mean GFP nuclear intensity. Average measurements from whole population of cells (i.e. not binned) are also shown. Each dot represents the fraction of 300–1800 alleles analyzed per bin (left panel) or the mean of 100–600 cells analyzed per bin (right panel). * P <0.05; ** P <0.01; *** P <0.001 [two-way ANOVAs followed by post-hoc Tukey tests (C,E,F and G, right panel); Marascuilo's procedure (G, left panel)].

Article Snippet: Synthetic single-guide RNAs (sgRNAs) were custom-ordered from Synthego (Reedwood City, CA, USA) and are listed in . sgRNAs were synthesized with a 2′-O-methyl modification at the three first and last bases, and 3′ phosphorothioate bonds between the third- and second-last bases for increased stability.

Techniques: Functional Assay, Stable Transfection, Expressing, Transfection, Control

(A) A single-guide RNA (sgRNA) containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego) of exon 7. To introduce the mutant sequence, we designed a single-stranded 199-base oligodeoxynucleotide (SPLIS ssOligo) containing the G-to-A SPLIS mutation and a silent point mutation to create a SphI restriction enzyme site for screening: 5’AGGCTGTACCTCCTGATACCCATCCTTAACTTACTCTGGTTTCTTTTCTTCACATAG GTGACTTCTGGGGGAACGGAAAGCATCCTGATGGCATGCAAAGCTTACCAGGACTT GGCGTTAGAGAAGGGGATCAAAACTCCAGAAATGTATGGATGTGTGTGTTTGTTTCC CTTCTGATATTGTCTATTTGTGGCAGCAC 3’ (Ultramer DNA, IDT). The C57BL/6J strain was used as an embryo donor. Fertilized oocytes were injected with Cas9 protein (TrueCut Cas9 protein V2, Thermofisher), the sgRNA, and the SPLIS ssOligo and transferred to the oviducts of pseudopregnant female mice. (B) Mice were genotyped by PCR. The resulting PCR product (443 bp) was digested with SphI to detect the mutant sequence. After digestion, the WT allele yielded a 443 bp fragment; the SPLIS-modified allele yielded 275 bp and 167 bp bands. We detected 1 founder whose PCR fragment was digested by SphI (out of 99 offspring screened). Sequences of the undigested PCR fragments were determined after TOPO TA cloning (ThermoFisher) by Sanger sequencing. The founder female carried one allele containing R222Q mutation and SphI restriction site and one allele with a 38-bp deletion in exon 7, resulting in a frameshift and premature stop codon (A, B). (C) When mated with a WT male, the founder produced 4 pups, 2 Sgpl1 R222Q/WT and 2 Sgpl1 del/WT, segregating the 2 alleles.

Journal: bioRxiv

Article Title: Pyridoxine supplementation confers protection against SGPL1 R222Q variant sphingosine phosphate lyase insufficiency syndrome

doi: 10.64898/2026.05.11.724358

Figure Lengend Snippet: (A) A single-guide RNA (sgRNA) containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego) of exon 7. To introduce the mutant sequence, we designed a single-stranded 199-base oligodeoxynucleotide (SPLIS ssOligo) containing the G-to-A SPLIS mutation and a silent point mutation to create a SphI restriction enzyme site for screening: 5’AGGCTGTACCTCCTGATACCCATCCTTAACTTACTCTGGTTTCTTTTCTTCACATAG GTGACTTCTGGGGGAACGGAAAGCATCCTGATGGCATGCAAAGCTTACCAGGACTT GGCGTTAGAGAAGGGGATCAAAACTCCAGAAATGTATGGATGTGTGTGTTTGTTTCC CTTCTGATATTGTCTATTTGTGGCAGCAC 3’ (Ultramer DNA, IDT). The C57BL/6J strain was used as an embryo donor. Fertilized oocytes were injected with Cas9 protein (TrueCut Cas9 protein V2, Thermofisher), the sgRNA, and the SPLIS ssOligo and transferred to the oviducts of pseudopregnant female mice. (B) Mice were genotyped by PCR. The resulting PCR product (443 bp) was digested with SphI to detect the mutant sequence. After digestion, the WT allele yielded a 443 bp fragment; the SPLIS-modified allele yielded 275 bp and 167 bp bands. We detected 1 founder whose PCR fragment was digested by SphI (out of 99 offspring screened). Sequences of the undigested PCR fragments were determined after TOPO TA cloning (ThermoFisher) by Sanger sequencing. The founder female carried one allele containing R222Q mutation and SphI restriction site and one allele with a 38-bp deletion in exon 7, resulting in a frameshift and premature stop codon (A, B). (C) When mated with a WT male, the founder produced 4 pups, 2 Sgpl1 R222Q/WT and 2 Sgpl1 del/WT, segregating the 2 alleles.

Article Snippet: We designed a single-guide RNA (sgRNA) containing a 20 bp target sequence, 5’ GATGGCCTGCAAAGCTTACC 3’ (Synthego), on mouse exon 7.

Techniques: Sequencing, Introduce, Mutagenesis, Injection, Modification, TA Cloning, Produced